paper n a pcmv6 ac rfp origene ps100034 software (OriGene)
OriGene is a verified supplier 
OriGene manufactures this product 
94
Structured Review
OriGene
paper n a pcmv6 ac rfp origene ps100034 software
Paper N A Pcmv6 Ac Rfp Origene Ps100034 Software, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Vector+Software/pCMV6-AC-RFP+Mammalian+Expression+Vector/pm42228570-355-74-77
Average 94 stars, based on 17 article reviews
Paper N A Pcmv6 Ac Rfp Origene Ps100034 Software, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Vector+Software/pCMV6-AC-RFP+Mammalian+Expression+Vector/pm42228570-355-74-77
Average 94 stars, based on 17 article reviews
paper n a pcmv6 ac rfp origene ps100034 software - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
Control:Article Title: GPNMB overexpression- a marker of resistance to CDK4/6 inhibitors Article Snippet: Lentiviral particles encoding the human GPNMB ORF (NM_001005340, GPNMB Human Tagged Lenti ORF clone, (OriGene cat# RC207615L4V, pLenti-C-mGFP-P2A-Puro) were obtained from OriGEne Technologies (Rockville, MD, USA). .. The pLenti-C-mGFP-P2A-Puro vector (OriGene cat# PS100093V) served as the Labeling:Article Title: GPNMB overexpression- a marker of resistance to CDK4/6 inhibitors Article Snippet: Lentiviral particles encoding the human GPNMB ORF (NM_001005340, GPNMB Human Tagged Lenti ORF clone, (OriGene cat# RC207615L4V, pLenti-C-mGFP-P2A-Puro) were obtained from OriGEne Technologies (Rockville, MD, USA). .. The pLenti-C-mGFP-P2A-Puro vector (OriGene cat# PS100093V) served as the Immunohistochemical staining:Article Title: Immunohistochemical analysis to detect a molecular signature in intervertebral disc degeneration Article Snippet: .. For immunohistochemical evaluation, sections were incubated overnight (4 °C) with a primary antibody against FOXO3a (#ab70315, rabbit anti-human, 1:100 dilution; Abcam, Cambridge, UK), SOD2 (#sc-133134, mouse anti-human, 1:100 dilution; Santa Cruz biotech., Dallas, USA), Incubation:Article Title: Immunohistochemical analysis to detect a molecular signature in intervertebral disc degeneration Article Snippet: .. For immunohistochemical evaluation, sections were incubated overnight (4 °C) with a primary antibody against FOXO3a (#ab70315, rabbit anti-human, 1:100 dilution; Abcam, Cambridge, UK), SOD2 (#sc-133134, mouse anti-human, 1:100 dilution; Santa Cruz biotech., Dallas, USA), other:Article Title: Identification of cycling regulatory T cell precursors as conductors of immune escape during breast carcinoma progression. Article Snippet: Article Identification of cycling regulatory T cell precursors as conductors of immune escape during breast carcinoma progression Article Title: Intratumoral microbiota and host genotype cooperatively shape neutrophil cytotoxic functions in colorectal cancer. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mice strain: NOD-rag-gamma-deficient (NRG) mice NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/ SzJ, Charles River, Italy) N/A Oligonucleotides Universal bacterial 16S rRNA gene primers; FW- TCCTACGGGAGGCAGCAGT; RWGGACTACCAGGGTATCTAATCCTGTT Microsynth N/A Fusobacterium nucleatum 16s rRNA gene primers; FW- GCCTCACAGCTAGGGACAAC; RWGAGTAAGGGCCGTGTCTCAG Microsynth N/A CXCL1 (human primers): Hs00236937_m1 Applied Biosystems Cat#4331182 CXCL2 (human primers): Hs00236966_m1 Applied Biosystems Cat# 4331182 CXCL5 (human primers): Hs00171085_m1 Applied Biosystems Cat# 4331182 CXL8 (human primers): Hs00174103_m1 Applied Biosystems Cat# 4331182 CD66b (human primers); FW- 5 ′ -TCAAAGCATTTGCAATCAGC-3 ′ ; RW- 5 ′ -GTGGGCAACTTCACAAAGGT-3 ′ Microsynth N/A GAPDH (human primers): Hs02786624_g1 Applied Biosystems Cat#4331182 SIGLEC-14 (human primers); FW: 5 ′ -AGGATTTATTCTCCCATCTCGCT-3 ′ ; RW: 5 ′ -GATGCTGATGGCGAGGTTCTG-3 ′ Sigma-Aldrich N/A SIGLEC-5 (human primers); FW: 5 ′ -GTGGTTCTGACATCTCACCTCATC-3 ′ ; RW: 5 ′ -CCTGAAGATGGTGATGGTCTG-3 ′ Sigma-Aldrich N/A Recombinant DNA pLenti-C-mGFP-P2A-Puro Origene Cat#PS100093 Human SIGLEC5 ORF clone (mGFP-tagged) Over Expression:Article Title: Impaired SOX17 Expression Causes Endothelial Dysfunction and Pulmonary Arterial Hypertension by Insufficient Suppression of RUNX1 Article Snippet: To generate stable SOX17 CRISPR/Cas9 knockout (KO) HPAECs, a single-guide RNA targeting the human SOX17 gene (5′-GTAGTACACGTGAAGGGCGC-3′) was cloned into the lentiCRISPRv2 vector (Addgene plasmid #52961). .. To generate Clone Assay:Article Title: Impaired SOX17 Expression Causes Endothelial Dysfunction and Pulmonary Arterial Hypertension by Insufficient Suppression of RUNX1 Article Snippet: To generate stable SOX17 CRISPR/Cas9 knockout (KO) HPAECs, a single-guide RNA targeting the human SOX17 gene (5′-GTAGTACACGTGAAGGGCGC-3′) was cloned into the lentiCRISPRv2 vector (Addgene plasmid #52961). .. To generate Produced:Article Title: Impaired SOX17 Expression Causes Endothelial Dysfunction and Pulmonary Arterial Hypertension by Insufficient Suppression of RUNX1 Article Snippet: To generate stable SOX17 CRISPR/Cas9 knockout (KO) HPAECs, a single-guide RNA targeting the human SOX17 gene (5′-GTAGTACACGTGAAGGGCGC-3′) was cloned into the lentiCRISPRv2 vector (Addgene plasmid #52961). .. To generate CRISPR:Article Title: Activity-regulated circSamm50 modulates mitochondrial dynamics and spine structural plasticity. Article Snippet: Four hours after plating, media was replaced with feeding media consisting of Neurobasal media supplemented with Glutamax, Penstrep, and 2% B27 (Invitrogen), and half of the media was replaced every 4 days until the time of experiments at 37◦C with 5% CO2. .. REAGENT or RESOURCE SOURCE IDENTIFIER Samm50 circ_F IDT TCATGAAGCCCGGGAAAAAC Samm50 circ_R IDT CAACTTCCACAAACTCGGCT Foxk2-1157_F IDT CTCCTCCTAACCCTGAACCACA Foxk2-1157_R IDT TCTCTCTTCTCGCTGGATAGGG Foxk2-1357_F IDT ATGTGGTACCCATGCCTACAG Foxk2-1357_R IDT TGCTTCTCTCTCTTCTCGCTG See Table S1-Primers for miRNA primers, CRISPR gRNA, linear RNA primers and insert sequences N/A Recombinant DNA pCMV6-AC-GFP Origene PS100010 pGL3 Basic Luciferase vector Promega E1751 pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4T2A-EGFP Addgene 228359 Samm50-WT-pGL3 This paper N/A Samm50-MUT-pGL3 This paper N/A circSamm50-WT- pGL3 This paper N/A circSamm50-MUT-pGL3 This paper N/A RCaMP1.07 This Recombinant:Article Title: Activity-regulated circSamm50 modulates mitochondrial dynamics and spine structural plasticity. Article Snippet: Four hours after plating, media was replaced with feeding media consisting of Neurobasal media supplemented with Glutamax, Penstrep, and 2% B27 (Invitrogen), and half of the media was replaced every 4 days until the time of experiments at 37◦C with 5% CO2. .. REAGENT or RESOURCE SOURCE IDENTIFIER Samm50 circ_F IDT TCATGAAGCCCGGGAAAAAC Samm50 circ_R IDT CAACTTCCACAAACTCGGCT Foxk2-1157_F IDT CTCCTCCTAACCCTGAACCACA Foxk2-1157_R IDT TCTCTCTTCTCGCTGGATAGGG Foxk2-1357_F IDT ATGTGGTACCCATGCCTACAG Foxk2-1357_R IDT TGCTTCTCTCTCTTCTCGCTG See Table S1-Primers for miRNA primers, CRISPR gRNA, linear RNA primers and insert sequences N/A Recombinant DNA pCMV6-AC-GFP Origene PS100010 pGL3 Basic Luciferase vector Promega E1751 pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4T2A-EGFP Addgene 228359 Samm50-WT-pGL3 This paper N/A Samm50-MUT-pGL3 This paper N/A circSamm50-WT- pGL3 This paper N/A circSamm50-MUT-pGL3 This paper N/A RCaMP1.07 This Luciferase:Article Title: Activity-regulated circSamm50 modulates mitochondrial dynamics and spine structural plasticity. Article Snippet: Four hours after plating, media was replaced with feeding media consisting of Neurobasal media supplemented with Glutamax, Penstrep, and 2% B27 (Invitrogen), and half of the media was replaced every 4 days until the time of experiments at 37◦C with 5% CO2. .. REAGENT or RESOURCE SOURCE IDENTIFIER Samm50 circ_F IDT TCATGAAGCCCGGGAAAAAC Samm50 circ_R IDT CAACTTCCACAAACTCGGCT Foxk2-1157_F IDT CTCCTCCTAACCCTGAACCACA Foxk2-1157_R IDT TCTCTCTTCTCGCTGGATAGGG Foxk2-1357_F IDT ATGTGGTACCCATGCCTACAG Foxk2-1357_R IDT TGCTTCTCTCTCTTCTCGCTG See Table S1-Primers for miRNA primers, CRISPR gRNA, linear RNA primers and insert sequences N/A Recombinant DNA pCMV6-AC-GFP Origene PS100010 pGL3 Basic Luciferase vector Promega E1751 pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4T2A-EGFP Addgene 228359 Samm50-WT-pGL3 This paper N/A Samm50-MUT-pGL3 This paper N/A circSamm50-WT- pGL3 This paper N/A circSamm50-MUT-pGL3 This paper N/A RCaMP1.07 This Plasmid Preparation:Article Title: Activity-regulated circSamm50 modulates mitochondrial dynamics and spine structural plasticity. Article Snippet: Four hours after plating, media was replaced with feeding media consisting of Neurobasal media supplemented with Glutamax, Penstrep, and 2% B27 (Invitrogen), and half of the media was replaced every 4 days until the time of experiments at 37◦C with 5% CO2. .. REAGENT or RESOURCE SOURCE IDENTIFIER Samm50 circ_F IDT TCATGAAGCCCGGGAAAAAC Samm50 circ_R IDT CAACTTCCACAAACTCGGCT Foxk2-1157_F IDT CTCCTCCTAACCCTGAACCACA Foxk2-1157_R IDT TCTCTCTTCTCGCTGGATAGGG Foxk2-1357_F IDT ATGTGGTACCCATGCCTACAG Foxk2-1357_R IDT TGCTTCTCTCTCTTCTCGCTG See Table S1-Primers for miRNA primers, CRISPR gRNA, linear RNA primers and insert sequences N/A Recombinant DNA pCMV6-AC-GFP Origene PS100010 pGL3 Basic Luciferase vector Promega E1751 pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4T2A-EGFP Addgene 228359 Samm50-WT-pGL3 This paper N/A Samm50-MUT-pGL3 This paper N/A circSamm50-WT- pGL3 This paper N/A circSamm50-MUT-pGL3 This paper N/A RCaMP1.07 This Software:Article Title: Activity-regulated circSamm50 modulates mitochondrial dynamics and spine structural plasticity. Article Snippet: Four hours after plating, media was replaced with feeding media consisting of Neurobasal media supplemented with Glutamax, Penstrep, and 2% B27 (Invitrogen), and half of the media was replaced every 4 days until the time of experiments at 37◦C with 5% CO2. .. REAGENT or RESOURCE SOURCE IDENTIFIER Samm50 circ_F IDT TCATGAAGCCCGGGAAAAAC Samm50 circ_R IDT CAACTTCCACAAACTCGGCT Foxk2-1157_F IDT CTCCTCCTAACCCTGAACCACA Foxk2-1157_R IDT TCTCTCTTCTCGCTGGATAGGG Foxk2-1357_F IDT ATGTGGTACCCATGCCTACAG Foxk2-1357_R IDT TGCTTCTCTCTCTTCTCGCTG See Table S1-Primers for miRNA primers, CRISPR gRNA, linear RNA primers and insert sequences N/A Recombinant DNA pCMV6-AC-GFP Origene PS100010 pGL3 Basic Luciferase vector Promega E1751 pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4T2A-EGFP Addgene 228359 Samm50-WT-pGL3 This paper N/A Samm50-MUT-pGL3 This paper N/A circSamm50-WT- pGL3 This paper N/A circSamm50-MUT-pGL3 This paper N/A RCaMP1.07 This Positive Control:Article Title: The insertion of an ATTTC repeat in an Alu element hyperactivates a neurodevelopmental enhancer in spinocerebellar ataxia type 37 Article Snippet: Membrane was stripped, re-probed with mouse anti-GAPDH antibody (1:20000, #HRP-60004, ProteinTech Group) overnight at 4°C and incubated with anti-mouse HRP-conjugated antibody (1:10000, #711-035-151, Jackson ImmunoResearch), as above for protein loading control. .. As positive control, total protein extracts were extracted from Transfection:Article Title: The insertion of an ATTTC repeat in an Alu element hyperactivates a neurodevelopmental enhancer in spinocerebellar ataxia type 37 Article Snippet: Membrane was stripped, re-probed with mouse anti-GAPDH antibody (1:20000, #HRP-60004, ProteinTech Group) overnight at 4°C and incubated with anti-mouse HRP-conjugated antibody (1:10000, #711-035-151, Jackson ImmunoResearch), as above for protein loading control. .. As positive control, total protein extracts were extracted from Expressing:Article Title: The insertion of an ATTTC repeat in an Alu element hyperactivates a neurodevelopmental enhancer in spinocerebellar ataxia type 37 Article Snippet: Membrane was stripped, re-probed with mouse anti-GAPDH antibody (1:20000, #HRP-60004, ProteinTech Group) overnight at 4°C and incubated with anti-mouse HRP-conjugated antibody (1:10000, #711-035-151, Jackson ImmunoResearch), as above for protein loading control. .. As positive control, total protein extracts were extracted from SDS Page:Article Title: The insertion of an ATTTC repeat in an Alu element hyperactivates a neurodevelopmental enhancer in spinocerebellar ataxia type 37 Article Snippet: Membrane was stripped, re-probed with mouse anti-GAPDH antibody (1:20000, #HRP-60004, ProteinTech Group) overnight at 4°C and incubated with anti-mouse HRP-conjugated antibody (1:10000, #711-035-151, Jackson ImmunoResearch), as above for protein loading control. .. As positive control, total protein extracts were extracted from |